Friday, December 20, 2019

GBIF metagenomics and metacrap

Yes, this is a clickbait headline, and yes, it may seem like shooting fish in a barrel to complain about crappy data in GBIF, but my point here is raise concerns about the impact of metagenomic data on GBIF, and how difficult it may be to track down the causes of errors.

I stumbled across this example while looking for specimen records for the genus Rafflesia, which are parasitic plants famous for the spectacular size of their flowers (up to 1m across).



The GBIF map for Rafflesia shows a few outliers. Unfortunately GBIF doesn't make it easy to drill down (why oh why can't we just click on the map and see the corresponding occurrences?) so I opened the map in iSpecies and clicked on each outlier in turn. The one in Vanuatu (438164267 from the Paris museum P00577336) is identified to genus level only and has the note:
Parasite terrestre, grande fleur orange au ras du sol. Incomplète suite à prédation. Très forte odeur désagréable. Récolté par Sylvain Hugel (photo) (alcool seul)
which Google translates as:
Terrestrial parasite, large orange flower at ground level. Incomplete due to predation. Very strong unpleasant odor. Collected by Sylvain Hugel (photo) (alcohol only)
Sounds a bit like Rafflesia but there's no photo or other information available online. Likewise there's no additional data for the record from Brazil (1090499968). There is a record from Madagascar that is accompanied by a photo, but it that looks nothing like Rafflesia (1261055923):


That leaves two records, 2018528337 (Rafflesia cantleyi) from off the coast of Peru, and 2014813273 (Rafflesia) off the coast of Australia. Both of these records are metagenomic. For example, occurrence 2018528337 is part of a dataset Amplicon sequencing of Tara Oceans DNA samples corresponding to size fractions for protists that, on the face of it, would be an unlikely source of occurrences of forest dwelling plants.

What we get in the GBIF occurrence record is a link to the pipeline used to generate the data (Pipeline version 4.1 - 17-Jan-2018), the sample (ERS491947), and an analysis (MGYA00167469) that summarises all the taxonomic data from the ocean water sample.



What we don't get in GBIF is an obvious way to try and figure out why GBIF thinks that large flowers live in the ocean. I followed the links from MGYA00167469 and downloaded a bunch of files, some in familiar formats (FASTA), others in formats I'd not seen before (e.g., HDF5). From the mapseq file we have the following line:

ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1 GFBU01000011.4303.6106 76 0.9634146094322205 79 3 0 6 88 1722 1804 +  sk__Eukaryota;k__Viridiplantae;p__Streptophyta;c__;o__Malpighiales;f__Rafflesiaceae;g__Rafflesia;s__Rafflesia_cantleyi 

This tells us that sequence ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1 matches GenBank sequence GFBU01000011, which is "Rafflesia cantleyi RC_11 transcribed RNA sequence" from a paper on flower development in Rafflesia cantleyi doi:10.1371/journal.pone.0167958. So, now we see why we think we have giant flowers off the coast of Peru.

The rest of the line has information on the match: the oceanic sequence has a 0.96 identity with the plant sequence, has 79 matches, 3 mismatches, and no gaps, which suggests that this is a short sequence. Going digging in the FASTA file I found the raw sequence, and it is indeed very short:

>ERR562574.2494029-BISMUTH-0000:2:112:3465:9749-2/89-1
GTCTAAGTGTCGTGAGAAGTTCGTTGAACCTGATCATTTAGAGGAAGTAGAAGTCGTAAC
AAGGTTTCCGTAGGTGAACCTGCGGAAGG


This short string is the evidence for Rafflesia in the ocean. Out of curiosity I ran this sequence through BLAST:

Query  1     GTCTAAGTGTCGTGAGAAGTTCGTTGAACCTGATCATTTAGAGGAAGTAGAAGTCGTAAC  60
             |||||||||||||| |||||||||||||||| ||||||||||||||| ||||||||||||
Sbjct  1683  GTCTAAGTGTCGTGGGAAGTTCGTTGAACCTTATCATTTAGAGGAAGGAGAAGTCGTAAC  1742

Query  61    AAGGTTTCCGTAGGTGAACCTGCGGAAGG  89
             |||||||||||||||||||||||||||||
Sbjct  1743  AAGGTTTCCGTAGGTGAACCTGCGGAAGG  1771

The top hit is Bathycoccus prasinos, a picoplanktonic alga with a world-wide distribution. This seems like a more plausible identification for this sequence (all the top 100 hits are very similar to each other, many are labelled as Bathycoccus).



So, there's something clearly amiss with the analysis of this dataset. Someone who knows more about metagenomics than I do will be better placed to explain why this pipeline got it so wrong, and how common this issue is.

Given the scale and automation of metagenomics, there will always be errors - that is inevitable. What we need is ways to catch those errors, especially ones that are going to "pollute" existing distribution data with spurious records (flowers in the ocean). And in a sense, GBIF excels at this in that it exposes data to a wider audience. If you work on marine microbiology you might not notice that your sequences apparently include forest plants, but if you work on forest plants you will almost certainly notice sequences occurring in the ocean.

A key feature of GBIF that makes it so useful is that, unlike many data repositories, it does not treat data as a "black box". GBIF is not like a library catalogue which merely tells you that they have books and where to find them, instead it is like Google Books, which can tell you which books contain a given phrase you are looking for. By opening up each dataset and indexing the contents, GBIF enables us to do data analysis (in much the same way that GenBank isn't just a catalogue of sequences, it enables you to search the sequences themselves).

This is a feature we risk losing if we treat metagenomics data as a black box. The Tara Oceans data that GBIF receives is simply a list of taxa at a locality, it's a checklist. We have to take it on trust that the taxonomic assignments are accurate, and it is not a trivial task to diagnose errors. Compare this to having the photo that accompanied the record from Madagascar, which helps us determine that the identification is wrong. Going forward, it would be helpful if we had metagenomic sequences available as part of the data download from GBIF. It's also worth considering whether GBIF should start doing its own analysis of sequence data, or asking its contributors to check that their taxonomic assignments are correct (e.g., running BLAST on the data). Otherwise GBIF users may end up having to filter their data for a growing number of completely spurious records.

Update

Looks like (occurrence 1261055923) is Langsdorffia:


Friday, December 13, 2019

The Semantic Web revisited: thoughts on SWAT4HCLS


This week I attended the SWAT4(HC)LS (Semantic Web Applications and Tools for Healthcare and Life Sciences) meeting in Edinburgh. Although a relatively small meeting, SWAT4(HC)LS attracts some big names in the field and featured keynotes by Denny Vrandečić (founder of Wikidata), Dov Greenbaum, Birgitta König-Ries, and Helen Parkinson.
For me this was a chance to get a sense of the state of the Semantic Web, and also to present a talk on biodiversity knowledge graphs. Given that this is a computer science meeting, you need to get a paper submitted and accepted in order to give a talk, so I hastily wrote up some notes on matching author names in taxonomic and bibliographic databases (there's a version of this on bioRxiv):
Page, R. D. M. (2019). Reconciling author names in taxonomic and publication databases. doi:10.1101/870170
Google the "Semantic Web" and pretty soon you discover that many people think it is dead (see Whatever Happened to the Semantic Web?). But it is still here, maybe partly because there is some ambiguity about just what it is. The 2003 paper "Which semantic web?" By Catherine C. Marshall and Frank M. Shipman (doi:10.1145/900051.900063) sketches three different Semantic Webs:


  1. a universal library, to be readily accessed and used by humans in a variety of information use contexts.
  2. the backdrop for the work of computational agents completing sophisticated activities on behalf of their human counterparts
  3. a method for federating particular knowledge bases and databases to perform
(1) is essentially what Google gives us, the ability to use a web browser to find stuff on the web, augmented by structured markup to help us do that (the "Library of Alexandria"). (2) is the idea of global ontologies, agents, and reasoning (the Knowledge Navigator), and (3) focusses on cross linking data in different databases (the "Federated Knowledge Base").

My own focus is very much in area (3), I want to link disconnected datasets together. Many of the presentations at SWAT4(HC)LS were more in area (2) and focussed on ontologies, especially medical. This is a world of big - not always open - ontologies, and lots of discussions about how to model data. In other words, what many people think of as the Semantic Web.

One of the nice things about the conference was the way people with posters got to give a lightning talk about their poster (I've seen this at VIZBI as well). I think this is a great idea and would love to see this at biodiversity conferences. The posters that I got the most out of were from the researchers at the DBCLS in Japan, such as TogoStanza (visualisations of SPARQL results), SPARQList (Markdown notebook for SPARQL), and Umaka Viewer (visualise classes in a SPARQL endpoint).

For fun I tried Umaka Viewer on my Ozymandias knowledge graph. You can see the results here.
It took about 30 minutes to generate the data for this visualisation, but it was fun to poke around at the internals of a knowledge graph that I had created. I discovered classes I'd forgotten I'd used!


As someone who spends a lot of time messing about with ways to collect, clean, and visualise data, it's no surprise that posters and presentations on tools for doing this are what I found most useful. The thing I find most appealing about the Semantic Web is the notion of having simple APIs that can query knowledge encoded in both web pages and databases (see also work by Franck Michel and colleagues on SPARQL Micro-Services, e.g. SPARQL Micro-Services Demo Page).

Tuesday, November 05, 2019

Thoughts on Biodiversity Next

It’s been a while since I’ve posted on iPhylo. Since returning from a fun and productive time in Australia there have been a bunch of professional and personal things that have needed attending too. In amongst all this I attended Biodiversity Next in Leiden, a large (by biodiversity informatics standards) conference with the tag line "Building a global infrastructure for biodiversity data. Together." In this post I try and bring together a few random thoughts on the conference (the Twitter hashtag #biodiversitynext gives a much broader sense of the conference).

Spectacle


The venue for the keynotes was delightful, and guest speakers were ushered on stage with a rock-star soundtrack (which, frankly, grated at bit). Some of the keynotes were essentially TED talks, such as Theo Jansen on his wonderful Strandbeest and Jalila Essaidi on bulletproof skin and other biotechnology. Interesting, polished, hopeful.



Some keynotes were pitches, such as Paul Hebert’s BIOSCAN where we divide the planet into a grid (of squares, really?) and sequence barcodes for everything within each grid. The theme was moving from “artisanal to industrial” scale. BIOSCAN has a rival, the Earth BioGenome Project (EBP) (see https://doi.org/10.1073/pnas.1720115115) which aims to sequence the whole genome of every eukaryote in 10 years (at a cost of $US 4.7 billion). BIOSCAN is a rather cheaper, although Herbert sees it as the precursor to a larger initiative. But what makes BioSCAN more appealing to me is that it includes and explicit geographical and ecological context. BIOSCAN is interested in what species occur where, and who they are interacting with (the “symbiome”). But not everyone is convinced that mega-genomics projects are a good idea, see for example Proposals to “sequence the DNA of all life on Earth” suffer from the same issues as “naming all the species” by @JeffOllerton.

Other keynotes that resonated with me were Maxwell Gomera’s where he points out that for many people biodiversity is a risk (including an anecdote about people in Namibia seeing biodiversity as attracting the unwanted attention of outside interests, and hence something to be actively minimised), and Jorge Soberon on just how much of biodiversity informatics is data driven and theory-free. The presentation by Ana María Hernández Salgar on IPBES was perhaps the least exciting keynote, arguably because she’s tackling a probably intractable problem. We have some spectacular technology for documenting and understanding biodiversity, but no obvious way to change or significantly influence human impacts on that biodiversity.

Optics


The conference managed to score a pretty spectacular own goal by having an all-white, all male panel (“manel”) for one session (moderated by Ely Wallis @elyw).



There was a pointed response to this later in the conference (again moderated by Ely).



Personally I felt that neither panel contributed much beyond platitudes. I don’t think panel discussions like these do much to explore ideas, they are much more about appearances and positions (which makes the manel even more unfortunate).

There were other comments that were tone deaf. One senior figure argued that “money wasn’t a problem”, the implication being that there’s lots of it around, we just have to figure out how to access it. Yet, one of the sessions I attended featured a young researcher from Brazil who had to crowdfund his attendance at the conference. Money (or rather its uneven distribution) is very much a problem.

Infrastructure


The conference had its own app, and it worked well. It certainly made it easier to plan the day, which sadly was mostly realising that the two topics that you were out interested in hearing about were on at the same time. Big conferences have this fundamental problem that there are too many people and too many talks for people to see everything. This makes the event more a statement about community being large enough to stage such an event, than actually being a place to learn what is going on. But I guess the combination of breaks between sessions, social events, and the pre-conference workshops mean there are times and spaces where things can actually get done.

Substance


There was a lot going on at the conference, I am going to pick out just a few highlights for me. These are obviously very biased, and I missed a lot of the talks.

Cordra

The thing I was most interested to learn about was the technology underpinning DISSCO’s approach to putting specimen records online. Alex Hardisty (@AlexHardisty) gave a nice demo of DISSCO’s approach, which uses Cordra. From Cordra’s website:
Cordra is a highly configurable open source software offered to software developers for managing digital objects with resolvable identifiers at scale.
Cordra is from the Corporation for National Research Initiatives (CNRI), the people behind the Handle system which underpins DOIs. It's a NoSQL data store that can generate and manage persistent identifiers (e.g., Handles). I’ve not been following DISSCO closely, but this approach makes a lot of sense, and it will be interesting to see how it develops. Alex demoed a “digital specimen repository”, for example the record for specimen BMNH:2006.12.6.40-41 is here: http://nsidr.org/#objects/20.5000.1025/486a7e883f14f88bba37. Early days, but digitial identifiers for specimens are going to be crucial to efforts to interlink biodiversity data.

Knowledge graphs

I did my best to spread the knowledge graph meme, and Wikidata is attracting growing interest. Unfortunately I couldn’t see Franck Michel’s (@franck_michel2) talk on Bioschemas, but the idea of having light-weight markup for life science data is very attractive. It seems that long-standing dreams of linking things together are starting to slowly take shape.


Traits

This is an area that I have not thought much about. The Encyclopaedia of Life tried to carve out a niche in this area (TraitBank) but their latest iteration abandons the JSON-LD they developed in version 2.0, which seems a strategic blunder given the growth of interest in knowledge graphs, Bioschemas, and Wikidata. It seems that people working on traits are in a sort of pre-GBIF phase looking for ways to integrate diverse data into one or more places where people can play with it. There’s a lot of excitement here, but lots of data wrangling issues to deal with.

Credit and identity

The hashtag #citetheDOI became something of a rallying cry for those interested in GBIF data. Citing data downloaded from GBIF enables GBIF to pass information on usage along to data providers. Yet another example of the most compelling use case for identifiers not being scientific but cultural.

“Get yourself an ORCID” was another rallying cry. The challenge here is that the most obvious beneficiary of you getting an ORCID is not (yet) you, which makes the sales pitch a bit tricky.


People

It may be partly an age thing, but an increasingly important aspect of conference alike this is the chance to catchup with people you know, as well as develop new contacts and (hopefully) have your preconceptions challenged by people smarter than yourself. I spent quite a bit of time with the BHL crowd, which meant teasing them about their obsession with old books, which did not end well:

It was also fun to see Roger Hyam (@RogerHyam) in action again. Roger has a knack for cutting through the noise to make tools that are useful. He gave a nice demo of using the International Image Interoperability Framework (IIIF) to display herbarium images. Under the hood IIIF is JSON-LD and models everything as an annotation, so I think this framework is going to see a lot more use across a range of biodiversity projects. It certainly inspired me to add IIIF to my newly relaunched BioStor.


Agency


It's more a kind of pragmatic Archimedean sense that you might be able to move some subset of the world connected to any system on which you have root access or any project for which you're building a key component—from the leverage point of the command line. (The Emergence of Digital Humanities by Steven E. Jones, emphasis added)
One final thought which struck me is the notion of "agency", in the sense of a person being able to do things. For me one of the joys of biodiversity informatics is that I can make stuff that seems useful (if only to me). If, say, BHL ignores articles, well, you can grab their data and build something that finds those articles. If the data is available, and you can code, then there are few limits to what you can do. Even if you can't code, limits to what people can do are being removed. You have citizen scientists like @SiobhanLeachman (who presented at Biodiversity Next) revelling in the wealth of tools such as Wikipedia, Wikidata, etc. that enable her to add to biodiversity knowledge.

Do that at scale, as demonstrated by Carrie Seltzer's keynote on iNaturalist, and you can get millions of data points added by a passionate, empowered community.

Yet, I would find myself talking to biodiversity professionals working at some of the world's leading museums and herbaria, and they had far less agency than someone like Siobhan. They have no influence over the databases and software they use, even trivial changes aren't made because... reasons. Seemingly obvious suggestions of things that could be done, or offers of additional data are met with responses along the lines of "even if you gave us that data, we couldn't do anything with it because there's not a field in our database."

As a somewhat cranky, independent-minded academic, I greatly value the freedom to create things, and I'm extremely lucky that I can do that. But it is interesting to see that people fascinated by science but who are not employed as scientists often have more agency than the professional scientists. And maybe that's why I'm resistant to large conferences such as Biodiversity Next (and processors such as e-Biosphere 09). They represent the increasing professionalisation of the field, and with that often comes decreasing agency. When I grow up, I want to be a citizen scientist.

Wednesday, August 21, 2019

Ozymandias in Canberra

On Tuesday I was in Canberra to visit the Australian National Insect Collection at CSIRO and give a talk on knowledge graphs. David Yeates, who was a post doc at the AMNH at the same time I was (more years ago than I care to remember), played host and provided lots of stimulating conversation on the state of taxonomy and systematics, the Atlas of Living Australia (ALA), the bias against small organisms (see the wonderful essay A Dream of Invertebrate Utopia), and the joys of code compliance and modern publishing (see "Are taxonomic publications involving nomenclatural acts on Early View Code compliant?" https://doi.org/10.1111/aen.12372).


My talk discussed the Ozymandias knowledge graph, and also show cased the demos Nicole Kearney and I had put together to show the ways we think the ALA could be enhanced using knowledge graphs. One of these (linking names to the literature) has already been discussed here (see Messages from Melbourne: Towards linking all the things). The second demo (Hero images) gives examples of taxa for which ALA has no images, despite such images being available in the published literature via the Biodiversity Literature Repository. For example, the weevil genus Trigonopterus Fauvel, 1862 is richly illustrated in "Revision of the Australian species of the weevil genus Trigonopterus Fauvel" https://doi.org/10.3897/zookeys.556.6126. With a SPARQL query we can link these images to the associated taxa and provide a richer user experience.


The third demo makes use of Wikidata queries to display information on authors of taxonomic work on Australian species. This is very much a work in progress, but could be extended into a directory of Australian taxonomists.

One application of such a directory could be to determine to what extent Australian taxonomy depends on international researchers. Initial results (https://w.wiki/6PX) show that researchers from multiple countries have contribute to knowledge about Australian animal taxonomy and systematics.

There is still a frighteningly large amount of data cleaning and linking to do, but I think we've only scratched the surface of how knowledge graphs can be used to enrich biodiversity databases.

Monday, July 15, 2019

Notes on collections, knowledge graphs, and Semantic Web browsers

While working with linked data and ways to explore and visualise information, I keep coming back to the Haystack project, which is now over a decade old. Among the tools developed was the Haystack application, which enabled a user to explore all sorts of structured data. Below is a screen shot of Haystack showing a sequence for Homo sapiens cyclin T1 (CCNT1), transcript variant a, mRNA. Note the use of a LSID to identify the sequence (LSIDs were actively being used to identify bioinformatics resources) urn:lid:ncbi.nlm.nih.gov.lsid.i3c.org:genbank:nm_001240.



For some background on the Haystack project see How to Make a Semantic Web Browser DOI:10.1145/988672.988707 (PDF) and Haystack: A Customizable General-Purpose Information Management Tool for End Users of Semistructured Data PDF.
One reason I keep coming back to the Haystack project is the notion of having a personal space for exploring linked data. One of the challenges of having a large knowledge graph is that it becomes hard to have "local" queries. That is, queries which are restricted to a subset of things that you care about.

For example, while playing around with Ozymandias I keep coming across interesting species, such as Milyeringa justitia (see FIGURE 5 in A new species of the blind cave gudgeon Milyeringa (Pisces: Gobioidei, Eleotridae) from Barrow Island, Western Australia, with a redescription of M. veritas Whitley).


If I want to explore this taxon in more detail I'd like to have the original description, any relevant DNA sequences (e.g., MG543430), any papers publishing those sequences (e.g., Multiple molecular markers reinforce the systematic framework of unique Australian cave fishes (Milyeringa : Gobioidei)), and phylogenetic analyses such as the paper The First Record of a Trans-Oceanic Sister-Group Relationship between Obligate Vertebrate Troglobites which establishes a link between Milyeringa and a genus of cave fish endemic to Madagascar (Typhleotris).

What I'd like to be able to do is collect all these sources (ideally by simply bookmarking the links), saving them as a "collection", then at some point exploring what the knowledge graph can tell me. The importance of having a collection is so that I can tell the knowledge graph that I just want to explore a subset of information. Without a collection it can be tricky to limit the scope of queries. For example, given a global knowledge graph such as Wikidata, how would you query just species found in Australia? You would typically rely on the species having either a property ("found in Australia"), or perhaps an identifier that is only used for Australian species. Neither of these is particularly satisfactory, especially if there isn't a property that fortuitously matches the scope or your inquiry.
Hence, I'm interested in having collections: lists of entities that I want to know more about. I need ways to create these collections, ways to describe them, and ways to explore them. In some ways the collections feature of EOL was close to what I'm after. In the previous version of EOL you could "collect" taxa that you were interested in (for example, species that were blue) (see I think I now "get" the Encylopedia of Life). Sadly, collections (along with JSON-LD export and stable image URLs) have vanished from the new EOL (which seems to be in a death spiral driven by some really unfortunate decisions). And collections need to be able to contain any entity, not just taxa.

One way to represent collections in the linked data world is using RSS feeds, or their schema.org descendant, the DataFeed (see also Google's Data Feed Validation Tool). So, we could collect a series of things we are interested in, create the corresponding DataFeed, import that into our Knowledge Graph and that would give us a way to scope our queries (using membership of the DataFeed to select the species, papers, sequences, etc. that we are interested in). As an aside, there's also some overlap with another MIT project of old, David Huynh's Parallax project which explored querying on a set of objects, rather than one object at a time. This is the functionality that a collection gives you (if you have a query language like SPARQL which can work on sets of things).

Returning to Haystack, I'm intrigued by the idea of building a personal linked data browser. In other worlds, a browser that stores data that is relevant to projects you are working on (e.g., blind fish) as collections (data feeds), but can query a global knowledge graph to augment that information. SPARQL supports federated queries, so this is eminently doable. The local browser would have its own triple store, which could be implemented using Linked Data Fragments.

For now this is just a jumble of poorly articulated ideas, but I think much of the power of linking data together will be lost until we have simple tools that enable us to explore the data in ways that are relevant to what we actually want to know. Haystack gives us one model of what such a tool could look like.

Friday, June 21, 2019

Messages from Melbourne: Towards linking all the things

I'm doing some work with Nicole Kearney (@nicolekearney) at the Melbourne Museum on the general theme of "linking all the things". It's the end of the first full week we've had, so here's a quick update of what we've been up to.

Brainstorming

The things we want to do are being captured as a project on GitHub. This is where we come up with ideas, comment on then, then try to figure out which ones can be done. So far there are three things we've made a serious start on.

Unpaywall

Unpaywall is a project by Impactstory. It is sort of a Sci-Hub without the legal issues (for the record, I think Alexandra Elbakyan's work on Sci-Hub is nothing short of heroic). Unpaywall scans open access archives for legal, freely available versions of articles and makes them easy to find. If you have Firefox or Chrome you can get a plugin that lights up if the paywall article you're looking at has a free version somewhere else.
Nicole has long wanted the BHL to provide data to Unpaywall, because BHL has open access versions of many papers relevant to taxonomy and biodiversity more broadly defined. After a bit of digging we figured out that Unpaywall didn't have access to BHL's data, so we've set about fixing that. We've got the data harvested, but we're still waiting for Unpaywall to process that data. So, for now, we're still waiting for the little green light to appear on pages such as this one: https://doi.org/10.1080/00222932208632640.


Adding taxonomic literature to Atlas of Living Australia

Part of "linking all the things" is making the taxonomic literature a first class citizen of biodiversity databases. It is frankly embarrassing to see how much better the scientific literature is handled by projects such as Wikipedia than scientific databases such as GBIF and the ALA. We've decided to try and do something about this by showing how easily the literature could be embedded into the existing ALA web site. Nicole crafted a mockup of the ALA names tab, and I wrote some code to make it "live". For example, if you click on this link you will see a list of publications for Pauropsalta herveyensis Owen & Moulds, 2016. Note that we have DOIs and links to BHL where ever possible (and we use Unpaywall's API to flag whether an article with a DOI is freely available). We want this literature (the primary evidence for what we know about a species) to be visible and accessible. The demo is powered by my Ozymandias project, but we hope to work out a mechanism for delivering the mapping between taxa and literature to ALA (and, indeed, anyone else) as a dataset.
Because Ozymandias only has data for animals, we've had to exclude plants from this demo. I'm frantically trying to figure out how to work with data in Australia's plant name databases to resolve this. I'm discovering that never mind having more than one name for the same species, taxonomists also delight in having many different ways of representing taxonomic information in their databases. So, plants will be a challenge.


Mapping taxonomists to ORCID and Wikidata

One reason for adding literature to taxonomic databases is to make the work of taxonomists more visible. One way to do this is to move beyond using only "dumb strings" as people names and linking taxonomists to their ORCIDs and to entries in Wikidata (this is something I touched on in Ozymandias, and David Shorthouse is doing on an epic scale in Bloodhound). We're playing with the idea of being able to generate a list of active taxonomists in Australia, linked to their identifiers and publications, solely based on querying Wikidata. The first step is to try and automate the initial mapping between taxonomists and Wikidata as much as possible, we've only just started looking at this.

Summary

It is early days, and we're still identifying things we could work on. As always, there are so manythings which could be done, we're hoping we can make progress on at least some of these in the next few weeks.

Tuesday, May 28, 2019

Frankenplace, geospatial search, and discrete global grid systems


Quick note on Frankenplace, a cool search tool that displays the geographic distribution of documents that match the user's query as a heatmap. Details of how the tool works are given in:
B. Adams, G. McKenzie, and M. Gahegan (2015) Frankenplace: Interactive Thematic Mapping for Ad Hoc Exploratory Searching. 24th International World Wide Web Conference (WWW 2015), http://dx.doi.org/10.1145/2736277.2741137
At the heart of the method is a discrete global grid that divides the world up into small areas of the same size. Topics are then geographically indexed, so that when a user searches, say, for "ebola", areas relevant to that query are highlighted (in this case, areas in Africa). It's striking example of querying data geographically, and one which I hope to explore further in the context of BHL and BioStor.


Update

I've put some notes on various discrete global grid systems in a repo on GitHub: RDF and discrete global grid systems.

Ozymandias meets Wikipedia, with notes on natural language generation

I've tweaked Ozymandias to now include short natural language summaries (snippets) for various taxa. This makes the output a little more friendly and informative. For example, here's a snippet from the page on Cephalodesmius, a dung beetle that makes its own dung.


These snippets come from Wikipedia, well actually, from the DBpedia project. Behind the scenes I have a script that takes the GBIF taxon id for an ALA taxon (if it exists), queries Wikidata for the corresponding taxon and any associate identifiers of interest, and if there's a link to an English language Wikipedia page I do a quick SPARQL query to DBpedia to retrieve the snippet of text. At some point all of this could be sped up by adding the relevant data to the triple store and doing the query locally but for now it works well enough.

Of course, many snippets are little more than stubs, e.g. the snippet for another dung beetle genus Diorygopyx doesn't tell us much more than we can get from the information already displayed.



But having a text summary still seems worthwhile, which raises the question of what to do when Wikipedia doesn't know anything about a taxon? Obviously, we could start editing Wikipedia to flesh out its content, but that will take a while to filter into databases such as DBpedia. Another approach is to generate snippets from the triple store itself, in other words, generate natural language summaries from structured data. For example, we could generate summaries such as "Diorygopyx is a genus of Scarabaeidae or scarab beetles in the superfamily Scarabaeoidea" fairly easily from knowing the taxonomic hierarchy and a few common names. But we could also do more. In browsing Ozymandias I'm struck at times by how much our knowledge of one taxon depends on a major piece of taxonomic work, often done some time ago. For example, The Australian Crickets (Orthoptera: Gryllidae). Academy of Natural Sciences of Philadelphia, Monograph 22 by Otte and Alexander (1983) is a monumental taxonomic monograph, and many Australian cricket genera had most (or all) of their species described in that work. Imagine having a snippet that mentioned that (e.g., "Most species in this genus were described in 1983, no species have been discovered since."). That would give the reader some useful information, and perhaps also prompt them to ask "so, why haven't any more species been described?".

I think there's scope here to make the output from triple stores (and other databases) more approachable using natural language generation. This is obviously a big area, and there are some very sophisticated approaches for outputting very natural language (think chatbots), perhaps the most striking example of which is Google Duplex.


But we don't need quite this level of sophistication, something using much simpler techniques (e.g., nalgene-js) would probably be enough. Armed with some basic facts from the triple store, and some simple templates, we could probably generate some useful text snippets for many taxa in Ozymandias, and indeed for other entities. For example, David Shorthouse is outputting simple text summaries of the contribution of taxonomists to specimen collection and identification:

Imagine extending this to take into account publications, geography, etc. I think there's lots of scope here for moving beyond just displaying data and trying to generate human-friendly summaries of data.

Wednesday, April 10, 2019

Ozymandias: A biodiversity knowledge graph published in PeerJ

My paper "Ozymandias: A biodiversity knowledge graph" has been published in PeerJ https://doi.org/10.7717/peerj.6739
The paper describes my entry in GBIF's 2018 Ebbe Nielsen Challenge, which you can explore here. I tweeted about its publication yesterday, and got some interesting responses (and lots of retweets, thanks to everyone for those).

Carl Boettiger (@cboettig) asked where the triples were, as did Kingsley Uyi Idehen (@kidehen). Doh! This is one thing I should have done as part of the paper. I've uploaded the triples to Zenodo, you can find them here: https://doi.org/10.5281/zenodo.2634326.

Donat Agosti (@myrmoteras) complained that my knowledge graph ignored a lot of available information, which is true in the sense that I restricted it to a core of people, publications, taxa, and taxonomic names. The Plazi project that Donat champions extracts, where possible, lots of detail from individual publications, including figures, text blocks corresponding to taxonomic treatments, and in some cases geographic and specimen information. I have included some of this information in Ozymandias, specifically figures for papers where they are available. For example, Figure 10 from the paper "Australian Assassins, Part I: A review of the Assassin Spiders (Araneae, Archaeidae) of mid-eastern Australia":



This figure illustrates Austrarchaea nodosa (Forster, 1956), and Plazi has a treatment of that taxon: http://treatment.plazi.org/id/1072F469192A5BA015A1AA70A36E2C92. This treatment comprises a series of text blocks extracted from the paper, so there is not a great deal I can do with this unless I want to parse the text (e.g., for geographical coordinates and specimen codes). So yes, there is RDF (see http://treatment.plazi.org/GgServer/rdf/1072F469192A5BA015A1AA70A36E2C92) but it adds little to the existing knowledge graph.
To be fair, for some treatments in Plazi are a lot richer, for example http://tb.plazi.org/id/A94487F7E15AFFA5FF682EE9FEB45F2C which has references, geographical coordinates, and more. What would be useful would be an easy way to explore Plazi, for example, if the RDF was dumped into a triple store where we could explore it in more detail. I hope to look into this in the coming weeks.

Sunday, March 24, 2019

Where is the damned collection? Wikidata, GrBio, and a global list of all natural history collections

One of the things the biodiversity informatics community has struggled to do is come up with a list of all natural history collections (Taylor, 2016). Most recently GrBio attempted to do this, and appealed for community help to curate the list (Schindel et al., 2016), but this did not emerge, and at the time of writing GrBio is moribund. GBIF has obtained GrBio's data and is now hosting it (GBIF provides new home for the Global Registry of Scientific Collections) but the problem of curation remains. Furthermore, GrBio is not the only contender for a global list of collections, the NCBI has their own list (Sharma et al. 2018).
When Schindel et al. came out I suggested that a better way forward was to use Wikidata as the data store for basic information on collections (see GRBio: A Call for Community Curation - what community?). David Shorthouse's work on linking individual researchers to the specimens they have collected (Bloodhound) has motivated me to revisit this. One of the things David is wants to do is link the work of individuals to the institutions that host the specimens they work on. For individuals the identifier of choice is ORCID, and many researcher's ORCID profiles have identifiers for the institution they work at. For example, my ORCID profile https://orcid.org/0000-0002-7101-9767 states that I work at Glasgow University which has the Ringgold number of 3526. What is missing here is a way to go from the institutional identifiers we use for specimens (e.g., abbreviations like "MCZ" for the Museum of Comparative Zoology) to identifier such as Ringgold that organisations such as ORCID use.
It turns out that many institutions with Ringgold numbers (and other identifiers, such as Global Research Identifier Database or GRID) are in Wikidata. So, if we could map museum codes (institutionCode in Darwin Core terms) to Wikidata, then we can close the loop and have common institutional identifiers for both where individuals are employed and the institutions that house the collections that they work on.
Hence, it seems to me that using Wikidata as the basis for a global catalogue of institutions housing natural history collections makes a lot of sense. Many of these institutions are already in Wikidata, and the community of Wikidata editors dwarfs the number of people likely to edit a domain-specific database (as evidenced by the failure of GrBio's call for community engagement with its database). Furthermore, Wikidata has a sophisticated editing interface, with support for multiple langages and adding the provenance of individual data entries.
To get a sense of what is already in Wikidata I've built a small tool called Where is the damned collection?. It's a simple wrapper around a SPARL query to Wikidata, and the display is modelled on the "knowledge panel" that you often see to the right of Google's search results. If you type in the acronym for an institution (i.e., the institutionCode) the tools attempts to find it.




Here are some more examples:

There are some challenges to using Wikidata for this purpose. To date there has been little in the way of a coordinated effort to add natural history collections. There are 121 institutions that have a Index Herbariorum code (Property P5858) associated with their Wikidata records, you can see a list here. There is also a property for Biodiversity Repository ID which supports the syntax GrBio used to create unique institutionCode's even when multiple institutions used the same code. This has had limited uptake so far only being a property for five Wikidata items.
However, there are more museums and herbaria in Wikidata. For example, if we search for herbaria, natural history museums, and zoological museums we find 387 institutions. This query is made harder than it should because there are multiple types that can be used to describe a natural history collection and they query only uses three of them.
Another source of entries in Wikidata is Wikispecies. There are two pages (Repositories (A–M) and Repositories (N–Z)) that list pages corresponding to different institutionCodes. I have harvested these and found 1298 of these in Wikidata. This indicates that a good fraction of the 7,097 institutions listed by GrBio already have a presence in Wikidata. At the same time, it rather complicates the task of adding institutions to Wikidata as we need to figure out how many of these stub-like entries based on institutionCodes represent institutions already in Wikidata. There are also https://en.wikipedia.org/wiki/List_of_herbaria and natural history museums on Wikipedia that can also be harvested and cross-referenced with Wikidata.
So, there is a formidable data cleaning task ahead, but I think it's worth contemplating. One thing I find particularly interesting are the links to social media profiles, such as Twitter, Facebook, and Instagram. This gives another perspective on these institutions - in a sense this is digitisation of experiences that one can have at those institutions. These profiles are also often a good sources of data (such as geographic location and address). And they give a foretaste of what I think we can do. Imagine the entire digital footprint of a museum or herbarium being linked together in one place: the social media profiles, the digitised collections, the publications for which it is a publisher, its membership in BHL, JSTOR, GBIF, and other initiatives, and so on. We could start to get a better sense of the impact of digitisation - broadly defined - on each institution.
In summary, I think the role of Wikidata in cataloguing collections is worth exploring, and there's a discussion of this idea going on at the GBIF Community Forum. It will be interesting to see where this discussion goes. Meantime, I'm messing about developing with some scripts to see how much of the data mapping and cleaning process can be automated, so that tools like Where is the damned collection? become more useful.
References
  • Schindel, D., Miller, S., Trizna, M., Graham, E., & Crane, A. (2016). The Global Registry of Biodiversity Repositories: A Call for Community Curation. Biodiversity Data Journal, 4, e10293. doi:10.3897/bdj.4.e10293
  • Sharma, S., Ciufo, S., Starchenko, E., Darji, D., Chlumsky, L., Karsch-Mizrachi, I., & Schoch, C. L. (2018). The NCBI BioCollections Database. Database, 2018. doi:10.1093/database/bay006
  • Taylor, M. A. (2016). “Where is the damned collection?” Charles Davies Sherborn’s listing of named natural science collections and its successors. ZooKeys, 550, 83–106. doi:10.3897/zookeys.550.10073

Wednesday, December 05, 2018

Biodiversity data v2Glasgow University's Institute of Biodiversity, Animal Health & Comparative Medicine, where I'm based, hosts Naturally Speaking featuring "cutting edge research and ecology banter". Apparently, what I do falls into that category, so Episode 65 features my work, specifically my entry for the 2018 GBIF Challenge (Ozymandias). The episode page has a wonderful illustration by Eleni Christoforou which captures the idea of linking things together very nicely. Making the podcast was great fun, thanks to the hosts Kirsty McWhinnie and Taya Forde. Let's face it, what academic doesn't love to talk about their own work, given half a chance? I confess I'm happy to talk about my work, but I haven't had the courage yet to listen to the podcast.

Ozymandias: A biodiversity knowledge graph available as a preprint on Biorxiv

LwyH1HFe 400x400I've written up my entry for the 2018 GBIF Challenge ("Ozymandias") and posted a preprint on Biorxiv (https://www.biorxiv.org/content/early/2018/12/04/485854). The DOI is https://doi.org/10.1101/485854 which, last time I checked, still needs to be registered.

The abstract appears below. I'll let the preprint sit there for a little while before I summon the enthusiasm to revisit it, tidy it up, and submit it for publication.

Enormous quantities of biodiversity data are being made available online, but much of this data remains isolated in their own silos. One approach to breaking these silos is to map local, often database-specific identifiers to shared global identifiers. This mapping can then be used to con-struct a knowledge graph, where entities such as taxa, publications, people, places, specimens, sequences, and institutions are all part of a single, shared knowledge space. Motivated by the 2018 GBIF Ebbe Nielsen Challenge I explore the feasibility of constructing a "biodiversity knowledge graph" for the Australian fauna. These steps involved in constructing the graph are described, and examples its application are discussed. A web interface to the knowledge graph (called "Ozymandias") is available at https://ozymandias-demo.herokuapp.com.

Thursday, November 15, 2018

Geocoding genomic databases using GBIF

LwyH1HFe 400x400I've put a short note up on bioRxiv about ways to geocode nucleotide sequences in databases such as GenBank. The preprint is "Geocoding genomic databases using GBIF" https://doi.org/10.1101/469650.

It briefly discusses using GBIF as a gazetteer (see https://lyrical-money.glitch.me for a demo) to geocode sequences, as well as other approaches such as specimen matching (see also Nicky Nicolson's cool work "Specimens as Research Objects: Reconciliation across Distributed Repositories to Enable Metadata Propagation" https://doi.org/10.6084/m9.figshare.7327325.v1).

Hope to revisit this topic at some point, for now this preprint is a bit of a placeholder to remind me of what needs to be done.

Thursday, October 25, 2018

Taxonomic publications as patch files and the notion of taxonomic concepts

There's a slow-burning discussion on taxonomic concepts on Github that I am half participating in. As seems inevitable in any discussion of taxonomy, there's a lot of floundering about given that there's lots of jargon - much of it used in different ways by different people - and people are coming at the problem from different perspectives.

In one sense, taxonomy is pretty straightforward. We have taxonomic names (labels), we have taxa (sets) that we apply those labels to, and a classification (typically a set of nested sets, i.e., a tree) of those taxa. So, if we download, say, GenBank, or GBIF, or BOLD we can pretty easily model names (e.g., a list of strings), the taxonomic tree (e.g., a parent-child hierarchy), and we have a straightforward definition of the terminal taxa (leaves) or the tree: they comprise the specimens and observations (GBIF), or sequences (GenBank and BOLD) assigned to that taxon (i.e., for each specimen or sequence we have a pointer to the taxon to which it belongs).

Given this, one response to the taxonomic concept discussion is to simply ignore it as irrelevant, and we can demonstrably do a lot of science without it. I suspect most people dealing with GBIF and GenBank data aren't aware of the taxonomic concept issue. Which begs the question, why the ongoing discussion about concepts?

Perhaps the fundamental issue is that taxonomic classification changes over time, and hence the interpretation of a taxon can change over time. In other words, the problem is one of versioning. Once again, the simplest strategy to deal with this is simply use the latest version. In much the same way that most of us probably just read the latest version of a Wikipedia page, and many of us are happy to have our phone apps update automatically, I suspect most are happy to just grab the latest version and do some, you know, science.

I think taxonomic concepts really become relevant when we are aggregating data from sources where the data may not be current. In other words, where data is associated with a particular taxonomic name and the interpretation of that name has changed since the last time the data was curated. If the relationships of a taxon or specimen can be computed on the fly, e.g. if the data is a DNA barcode, then this issue is less relevant because we can simply re-cluster the sequences and discover where the specimen with that sequence belongs in a new classification. But for many specimens we don't have sufficient information to do this computation (this is one reason DNA barcodes are so useful, everything needed to determine a barcode's relationship is contained in the sequence itself).

To make this concrete, consider the genus Brookesia in GBIF (GBIF:2449310.

Screenshot 2018 10 25 11 43

According to Wikipedia Brookesia is endemic to Madagascar, so why does it appear on the African mainland? There are two records from Africa, Brookesia brookesia ionidesi collected in 1957 and Brookesia temporalis collected in 1926. Both represent taxa that were in the genus Brookesia at one point, but are now in different genera. So our notion of Brookesia has changed over time, but curation of these records has yet to catch up with that.

So, what would be ideal would be if we have a timestamped series of classifications so that we could go back in time and see what a given taxon meant at a given time, and then go forward to see the status of that taxon today. Having such a timestamped series is not a trivial task, indeed it may only be available in well studied groups. Birds are one such group, where each year eBird updates the current bird classification based on taxonomic activity over the previous year. As part of the Github discussion I posted visual "diff" between two bird classifications:

45759416 c9c5ed80 bc1f 11e8 98ca 5f4554ddca42

You can see the complete diff here, and the blog post Visualising the difference between two taxonomic classifications for details on the method.. The illustration above shows the movement of one species from Sasia to Verreauxia.

So, given two classifications we can compute the difference between them, and represent that difference as an "edit script" or operations to convert one tree into another. These edits are essentially what taxonomists do when they revise a group, they do things such as move species form one genus to another, merge some taxa, sink others into synonymy, and so on. So, taxonomy is essentially creating a series of edit files ("patches") to a classification. At a recent workshop in Ottawa Karen Cranston pointed out that the Open Tree of Life has been accumulating amendments to their classification and that these are essentially patch files.

Hence, we could have a markup language for taxonomic work that described that work in terms of edit operations that can then be automatically applied to an existing classification. We could imagine encoding all the bird taxonomy for a year in this way, applying those patches to the previous years' tree, and out pops the new classification. The classification becomes an evolving document under version control (think GitHub for trees). Of course, we'd need something to detect whether two different papers were proposing incompatible changes, but that's essentially a tree compatibility problem.

One way to store version information would be to use time-based versioned graphs. Essentially, we start with each node in the classification tree having a start date (e.g., 2017) and an open-ended end date. A taxonomic work post 2017 that, say, moved a species from one genus to another would set the end date for the parent-child link between genus and species, and create a new timestamped node linking the species to its new genus. To generate the 2018 classification we simply extract all links in the tree whose date range includes 2018 (which means the old generic assignment for the species is not included). This approach gives us a mechanism for automating the updating of a classification, as well as time-based versioning.

I think something along these lines would create something useful, and focus the taxonomic discussion on solving a specific problem.

Wednesday, October 24, 2018

Specimens, collections, researchers, and publications: towards social and citation graphs for natural history collections

Being in Ottawa last week for a hackathon meant I could catch up with David Shorthouse (@dpsSpiders. David has been doing some neat work on linking specimens to identifiers for researchers, such as ORCIDs, and tracking citations of specimens in the literature.

David's Bloodhound tool processes lots of GBIF data for occurrences with names of those who collected or identified specimens. If you have an ORCID (and if you are a researcher you really should) then you can "claim" your specimens simply by logging in with your ORCID. My modest profile lists New Zealand crabs I collected while an undergraduate at Auckland University.

Screenshot 2018 10 24 18 11

Unlike many biodiversity projects, Bloodhound is aimed squarely at individual researchers, it provides a means for you to show your contribution collecting and identifying the world's biodiversity. This raises the possibility of one day being able to add this information to your ORCID profile (in the way that currently ORCID can record your publications, data sets, and other work attached to a DOI). As David explains:

A significant contributing factor for this apparent neglect is the lack of a professional reward system; one that articulates and quantifies the breadth and depth of activities and expertise required to collect and identify specimens, maintain them, digitize their labels, mobilize the data, and enhance these data as errors and omissions are identified by stakeholders. If people throughout the full value-chain in natural history collections received professional credit for their efforts, ideally recognized by their administrators and funding bodies, they would prioritize traditionally unrewarded tasks and could convincingly self-advocate. Proper methods of attribution at both the individual and institutional level are essential.

Attribution at institutional level is an ongoing theme for natural history collections: how do they successfully demonstrate the value of their collections?

Mark Carnall's (@mark_carnall) tweet illustrates the mismatch between a modern world of interconnected data and the reality of museums trying to track usage of their collections by requesting reprints. The idea of tracking citations of specimens and or collections has been around for a while. For example, I did some work text mining BioStor for museum specimen codes, Ross Mounce and Aime Rankin have worked on tracking citations of Natural History Museum specimens (https://github.com/rossmounce/NHM-specimens), and there is the clever use of Google Scholar by Winker and Withrow (see The impact of museum collections: one collection ≈ one Nobel Prize and https://doi.org/10.1038/493480b).

David has developed a nice tool that shows citations of specimens and/or collections from the Canadian Museum of Nature.

Screenshot 2018 10 24 14 10

I'm sure many natural history collections would love a tool like this!

Note the altmetric.com "doughnuts" showing the attention each publication is receiving. These doughnuts are possible only because the publishing industry got together and adopted the same identifier system (DOIs). The existence of persistent identifiers enables a whole ecosystem to emerge based around those identifiers (and services to support those identifiers).

The biodiversity community has failed to achieve something similar, despite several attempts. Part of the problem is the cargo-cult obsession with "identifiers" rather than focussing on the bigger picture. So we have various attempts to create identifiers for specimens (see "Use of globally unique identifiers (GUIDs) to link herbarium specimen records to physical specimens" https://doi.org/10.1002/aps3.1027 for a review), but little thought given to how to build an ecosystem around those identifiers. We seem doomed to recreate all the painful steps publishers went through as created a menagerie of identifiers (e.g., SICIs, PII) and alternative linking strategies ("just in time" versus "just in case") until they settled on managed identifiers (DOIs) with centralised discovery tools (provided by CrossRef).

Specimen-level identifiers are potentially very useful, especially for cross linking records in GBIF, GenBank, and BOLD, as well as tracking citations, but not every taxonomic community has a history of citing specimens individually. Hence we may also want count citations at collection and institutional level. Once again we run into the issue that we lack persistent, widely used identifiers. The GRBio project to assign such identifiers has died, despite appeals to the community for support (see GRBio: A Call for Community Curation - what community?). Given Wikidata's growing role as an identity broker, a sensible strategy might be to focus on having every collection and institution in Wikidata (many are already) and add the relevant identifiers there. For example, Index Herbarium codes are now a recognised property in Wikidata, as seen in the entry for Cambridge University Herbarium (CGE).

But we will need more than technical solutions, we will also need compelling drivers to track specimen and collection use. The success of CrossRef has been due in part to the network effects inherent in the citation graph. Each publisher has a vested interest in using DOIs because other CrossRef members will include those DOIs in the list of literature cited, which means that each publisher potentially gets traffic from other members. Companies like altmetric.com (of doughnut fame) make money by selling data on attention papers receive to publishers and academic institutions, based on tracking mention of identifiers. Perhaps natural history collections should follow their lead and ask how they can get an equivalent system, in other words, how do we scale tools such as the Canadian Museum of Nature citation tracker across the whole network? And in particular, what services do you want and how much would those services be worth to you?

Ottawa Ecobiomics hackathon: graph databases and Wikidata

Flag of Canada Pantone svg I spent last week in Ottawa at a "Ecobiomics" hackathon organised by Joel Sachs. Essentially we spent a week exploring the application of linked data to various topics in biodiversity, with an emphasis on looking at working examples. Topics covered included:

In addition to the above I spent some of the time working on encoding GBIF specimen data in RDF with a view to adding this to Ozymandias. Having Steve Baskauf (@baskaufs) at the workshop was a great incentive to work on this, given his work with Cam Webb on Darwin-SW: Darwin Core-based terms for expressing biodiversity data as RDF.

A report is being written up which will discuss what we got up to in more detail, but one take away for me is the large cognitive burden that still stands in the way of widespread adoption of linked data approaches in biodiversity. Products such as Metaphactory go some way to hiding the complexity, but the overhead of linked data is high, and the benefits are perhaps less than obvious. Update: for more o this see Dan Brickley's comments on "Semantic Web Interest Group now closed".

In this context, the rise of Wikidata is perhaps the most important development. One thing we'd hoped to do but didn't get that far was to set up our own instance of Wikibase to play with (Wikibase is the software that Wikidata runs on). This is actually pretty straightforward to do if you have Docker installed, see this great post in Medium Wikibase for Research Infrastructure — Part 1 by Matt Miller, which I stumbled across after discovering Bob DuCharme's blog post Running and querying my own Wikibase instance. Running Wikibase on your own machine (if you follow the instructions you also get the SPARQL query interface) means that you can play around with a knowledge graph without worrying about messing up Wikidata itself, or having to negotiate with the Wikidata community if you want to add new properties. It looks like a relatively painless way to discover whether knowledge graphs are appropriate for the problem you're trying to solve. I hope to find time to play with Wikibase further in the future.

I'll update this blog post as the hackathon report is written.

GBIF Ebbe Nielsen Challenge update

Quick note to express my delight and surprise that my entry for the 2018 GBIF Ebbe Nielsen Challenge come in joint first! My entry was Ozymandias - a biodiversity knowledge graph which built upon data from sources such as ALA, AFD, BioStor, CrossRef, ORCID), Wikispecies, and BLR.

I'm still tweaking Ozymandias, for example adding data on GBIF specimens (and maybe sequences from GenBank and BOLD) so that I can explore questions such as what is the lag time between specimen collection and description of a species. The bigger question I'm interested in is the extent to which knowledge graphs (aka RDF) can be used to explore biodiversity data.

For details on the other entries visit the list of winners at GBIF. The other first place winners Lien Reyserhove, Damiano Oldoni and Peter Desmet have generously donated half their prize to NumFOCUS which supports open source data science software:

This is a great way of acknowledging the debt many of us owe to developers of open source software that underpins the work of many researchers.

I hope GBIF and the wiser GBIF community found this year's Challenge to be worthwhile, I'm a big fan of anything which increases GBIF's engagement with developers and data analysts, and if the challenge runs again next year I encourage anyone with an interest in biodiversity informatics to consider taking part.